Biology on Peter Klipfel

Gene libraries

Sun, 22 May 2022 22:22:22 -0700

What are gene libraries

At a high level, gene libraries are collections of DNA fragments from a genome. The library may contain the whole genome, or it may contain only a section of the genome.

There are 2 primary kinds of gene libraries

Geonmic libraries
cDNA libraries

Genomic libraries

This is the complete collection. If you want all the DNA from an organism, you are going to be creating a genomic library. At first, I thought this was the obvious choice for building a useful library, but I had overlooked the fact that lots of DNA isn’t particularly useful (as far as we know), and even less of it is likely to be useful for your particular area of study.

Cosmids

Sat, 19 Mar 2022 08:00:31 -0700

What are cosmids?

Special plasmids

Cosmids are just a specific kind of plasmid, which are indpendent units of DNA that can move between bacteria. That is, they are similar to viruses in that they’re in the gray area of what we might consider “life”, but they are different from viruses in that they do not code for their own protective membrane like a virus or a cell would.

One misconception that I had during my learning about cosmids was how they can have longer sequences than regular plasmids. I had believed that there was some physical limitation in the length of a plasmid, and was confused how a cosmid could support larger DNA fragments if they were also plasmids. The problem with longer plasmids isn’t necessarily that there is a physical limitation but that longer DNA fragments have higher liklihoods of being transcribed incorrectly (because cells are probabilistic chemical soups), so as you make the fragments longer, you get lower yield of your desired DNA.

Cell Lysis

Sat, 20 Jun 2020 21:12:22 -0700

Overview

Cells are just pockets of proteins in a bubble of fat. You may know fat by the way that it sticks to your pans after you’re done cooking. It’s the layer of grease that coats your cookware. Typically, you can’t just rinse the grease away, you need an agent that breaks up the grease.

Broadly speaking, cells are made up of similar stuff to the grease that’s on your plates and pans. It’s a protective layer that constitutes the cell wall. This is why you can do at-home experiments where you isolate DNA using soap. The soap is used as a way to break open the cell so you can get at the DNA.

Growing neurons Overview

Sat, 09 May 2020 09:18:20 -0400

Overview

Neurons are usually “grown” in two steps. First, they reproduce to become more cells. This is the intuitive meaning of cells growing (at least to me), and will be the subject of this post. Then, they are differentiated into the necessary neuronal cells that make up the culture. These are broadly divided into neural cells and glial cells.

Neural cells

These are the cells that are typically depicted as brain cells in popular culture. They connect to one another by long tendrils called dendrites. When they are connected, the connection forms an axon, along which a signal flows. This is the part of your brain that does the thinking. These are the pathways that fMRI machines read when they’re looking for patterns in the brain.

Cryopreservation

Sat, 25 Apr 2020 11:52:57 -0400

Overview

Let’s suppose you want to store cell lines for future use. The most obvious option would be to put them in an incubator and let them continue growing. But this would require some maintenance, and it’s pretty inconvenient if you want to do other things like move the cells. Another option might be to freeze them. But this has a pretty high liklihood of killing cells. When water freezes, the ice crystals in the cell can wreak havoc on the cell. Thankfully we’ve found ways around this.

MAP kinase

Sat, 11 Apr 2020 16:12:02 -0400

Overview

I’ve been learning about systems biology recently, and MAP Kinase seems to come up a lot. Systems biology is all about drawing maps between various biological processes like which genes create what proteins and how those proteins interact with each other. MAP kinase is often shown as an intermediary between various processes. MAP stands for Mitogen Activated Protein. This seems pretty self-explanatory if we understand what a “Mitogen” is. So let’s go over that.

Immortal cell lines

Sun, 29 Mar 2020 20:37:42 -0400

Overview

Say you want to study a new drug, and you want to see if there are any interesting effects on human tissue. Maybe you’ve infected the tissue with a virus, and you want to see if the drug does what you think it does. It’s still early in the study, so you don’t want to give it to real humans yet.

This is a very common practice, but it assumes that you can get tissue easily. But how would you actually get it? You could grab a chunk of tissue from your arm or something, but this comes with problems; for example, contamination. It would be better to grow the tissue in a lab. One way that we could do this is with stem cells, but that seems costly. Stem cells are expensive, and often hard to come by, though this is an improvement on scraping some of your skin off. It would be more convenient if there was a type of human cell which grew on its own forever, like yeast. Normally, in an animal, we would call this cancer. But in biology, we get to call it an immortal cell line.

Building proteins

Sat, 07 Mar 2020 13:41:12 -0500

Overview

I’ve been wondering about the differences between proteins and enzymes, and thought it would be good to start from first principles. In this post, I wanted to talk broadly about how proteins are made from DNA.

Amino acids

DNA is made of strings like GCCCGTAATAGTACATTACGA; This is translated in triplets into amino acids, and groups of amino acids produce proteins. So, if we grouped this into triplets, it would look like: (GCC)(CGT)(AAT)(AGT)(ACA)(TTA)(CGA). There are 22 known amino acids. Conveniently, this is less than the number of letters in the alphabet, so we assign each amino acid a letter of the alphabet. Unfortunately, this was not a well planned system, so the names of the amino acids do not follow all the letters of the alphabet. The missing letters are B, J, X, Z. These letters have been repurposed to communicate ambiguity.

Lac operon

Fri, 07 Feb 2020 16:47:28 -0700

Overview

The first word in “lac operon” refers to lactose, and the second word refers to the structure of the genes. Usually, when people discuss the lac operon, they do so in the context of e. coli. Though e. coli is not the only bacteria that can have the lac operon, it’s usually what people are referring to. I will continue that tradition.

Lactose is a type of sugar often found in milk. You may have heard of people being “lactose” intolerant. Well, the stuff that they are intolerant to is a type of sugar that can be broken down for energy by e. coli. However, e. coli doesn’t particularly like it either. It takes less energy for e. coli to break down glucose - a different type of sugar. Lactose is the sub-optimal choice for food for e. coli, and the e. coli happens to have a useful mechanism for determining when to digest it.

DNA methylation in prokaryotes

Fri, 31 Jan 2020 21:42:47 -0700

Introduction

I was researching possible failure modes of plasmid transfection in e. coli, and I came across a post that mentioned DNA methylation as a possible problem. I had not dug into this before, and discovered that it is an entire field of study within biology. Before I realized how broad the topic was, I anticipated writing this blog post on DNA methylation; I then reduced its scope to only prokaryotes, though I will talk a little bit about how DNA methylation affects eukaryotic organisms as well in order to provide more context for what it does and how it works.

Coronavirus

Fri, 24 Jan 2020 17:08:58 -0700

Which Coronavirus?

There are many types of coronaviruses. Similarly to cancer, if we say “she is sick with coronavirus”, there are several questions that are left unanswered. If we were to say “she is sick with cancer”, we might follow up with “what kind of cancer?”. There are 7 known coronaviruses that infect humans

Human coronavirus 229E (HCoV-229E)
Human coronavirus OC43 (HCoV-OC43)
SARS-CoV
Human coronavirus NL63 (HCoV-NL63, New Haven coronavirus)
Human coronavirus HKU1
Middle East respiratory syndrome coronavirus (MERS-CoV), previously known as novel coronavirus 2012 and HCoV-EMC.
Novel coronavirus (2019-nCoV), also known as Wuhan pneumonia or Wuhan coronavirus

Because there are so few known forms of the virus, when a new one is discovered, it is called “novel”. That’s why MERS was previously known as “Novel coronavirus 2012”. Once we know what they are, they get an identifier. MERS became HCoV-EMC because it was discovered by people at Erasmus Medical Center, and they got to name it. HKU-1 has its identifier because it was discovered by researchers in Hong Kong. In this case, discovery means that the gene sequence was verified.

Gene transfer in plants

Fri, 17 Jan 2020 22:24:10 -0700

Overview

Recently, I’ve been thinking it would be really cool to have a synthetic greenhouse; full of plants that could be found nowhere in nature. Flowers that glow in the dark, leaves that fluoresce under UV light, cucumbers that smell like vanilla, potatoes that taste like oranges. I’m getting a little ahead of myself, but it would be cool.

This post will go over some techniques that are used to introduce new genes into plants.

Creating a virus

Fri, 10 Jan 2020 15:59:55 -0700

Overview

Previously, I’ve talked about transfection of e. coli using heat shock in my post on plasmids. Transfection into single celled organisms can be relatively simple. Using heat and electricity, we can take an artificial plasmid and add it to e. coli or yeast. This synthetic addition to the DNA in a cell codes for a protein that we want, and the cell will now produce that protein like a small factory.

DNA Extraction

Fri, 03 Jan 2020 18:50:34 -0700

Overview

One project that I’ve had in the back of my mind is inventing new dyes based on colors in insects. Dyes created by biological mechanisms can be much more environmentally friendly than those created with chemicals. Unfortuantely, I have not found anywhere to buy the DNA that I want - in many cases, the genomes haven’t even been sequenced yet. Both of these problems will require me to isolate the DNA myself. There are different techniques for extracting DNA from different organisms, and here I’ll do my best to stick to broadly applicable techniques.

DNA sequencing methods

Fri, 27 Dec 2019 19:07:01 -0700

Overview

One of the driving factors behind the recent explosion in progress in synthetic biology has to do with the cost and speed of genome sequencing and synthesis. Here, I’m going to focus on genome sequencing. There are lots of companies that will do this for you, and lots of lab devices that you can buy so that you don’t have to do the sequencing yourself, but I thought it would be worthwhile for me to understand what it takes to sequence DNA.

Bioinformatics

Fri, 20 Dec 2019 21:58:09 -0700

Why do I care about this?

In this post, I wanted to go over what bioinformatics does for synthetic biologists. I’m a software engineer by training, and I’ve even taken some of a bioinformatics course. But I still didn’t understand what the purpose of bioinformatics was. More importantly, I didn’t understand how what I do for a living now - AI - could help with it.

Bioinformatics is an entire field, so I’m not going to be able to do it justice in a single blog post. The goal here is to do an overview of what bioinformatics is. There are books written about most of the subjects here, and I may go into many of them in future blog posts.

Bacterial artificial chromosomes (BAC)

Thu, 12 Dec 2019 22:02:15 -0700

What is a BAC?

Previously, I wrote about plasmids as small, circular DNA sequences. The double edged sword of normal plasmids is that they are small. This can make them easier to reason about, but it can make them inconvenient for some uses. For example, if you wanted to study the herpes virus, it might be useful to have bacteria that carry the genome of the virus. BACs allow biologists to study organisms more holistically, but without having to actually raise the organism.

Useful resources

Sun, 08 Dec 2019 19:17:25 -0700

What is this?

This is a list of resources that I have found to be useful in my own exploration and learning. I will continue to update it based on what I use.

Resources

protocols.io - lots of open protocols
openwetware - open protocols
Benchling - Bunches of useful tools for labs
bitesizebio - Lots of useful articles
Thermo Fisher’s list of lab protocols
diy-bio - Has tons of links, guides, and help to get people started in synthetic biology
bio-hk

Plasmids

Sat, 07 Dec 2019 21:44:22 -0700

What is a plasmid?

Whenever I start looking into genes and genomes, I eventually end up at a circular diagram with highlighted sections with gene name labels. I understood that these represented genetic information, but I didn’t really understand why I should care about them.

Being new at this whole biology thing forces me to remind myself of the fundamentals pretty often. In this case, I have to go back to the fundamentals of what DNA actually is. DNA is just a big string of amino acids which proteins interact with to produce more proteins. The DNA doesn’t even need to be in a cell. It just needs to exist in the right ratio with other proteins and amino acids to produce the protiens that are coded for.

Polymerase Chain Reaction (PCR)

Wed, 27 Nov 2019 21:41:38 -0700

Why do synthetic biologists use PCR?

One of the foundations of synthetic biology is being able to put new genes into organisms that did not previously have them. Unfortunately, genes don’t naturally come in buckets of purified DNA segments; we have to make those ourselves. And this is where PCR comes in. If you happened to find a really cool jelly fish that glowed under UV light, you sequenced that jellyfish’s genome, and identified the gene that makes it glow, you might be able to take that gene from the jellyfish and add it to other organisms in order to make them glow as well. Let’s assume for this explanation that we have already identified the gene that causes the jellyfish to glow, and that we have a tank full of these jellyfish.

Why I'm writing a synthetic biology blog

Fri, 22 Nov 2019 20:26:18 -0700

Back when I was first starting on my adventures in software, there was so much to learn. Even with the copious resources available, I still found it difficult to wrap my head around concepts that people were writing about. I felt like if someone could frame the problem for me correctly - and sometimes someone would - then I would have been able to learn things much faster. This will be a blog about my adventures into biology. It is meant to be a practical guide to building and editing the substrate of which we are an outgrowth.