-
On Remote Work
How Remote work has affected me I’m writing this while lying on the living room floor with a pillow under me. This is a practice I developed while working through some chronic pain. I was unable to sit for long periods, and I didn’t have a standing desk (and standing doesn’t work as well as laying down for me). I find that it provides me with a nice, low intensity shoulder workout, stretches some of the muscles that form when I’m hunched over a computer while sitting, and let’s me flop over when I want to think.
-
Project graveyards as guideposts
tl;dr Look for patterns in your past projects as guideposts for important decisions.
Inspiration I was recently listening to the Capital Allocators Podcast, and someone finally put into words an idea that I’ve struggled to articulate - research graveyards. In a discussion about hiring quants, one of the things they look for is a “research graveyard”. The idea is that they want to see someone who has tried a ton of things, and can lean on that experience.
-
How I manage my notes
Tl;dr I use obsidian for desktop, IA Writer for mobile, and keep everything in sync with Dropbox.
Taking notes is hard During college, while I was freelancing, I developed a habit of taking notes. This has served me well since then, and I have tried to manage my notes in more ways than I can remember.
The ones that I can remember trying are: Google Keep, Google Docs, Evernote, Jupyter notebooks, Aha!
-
Cell Lysis
Overview Cells are just pockets of proteins in a bubble of fat. You may know fat by the way that it sticks to your pans after you’re done cooking. It’s the layer of grease that coats your cookware. Typically, you can’t just rinse the grease away, you need an agent that breaks up the grease.
Broadly speaking, cells are made up of similar stuff to the grease that’s on your plates and pans.
-
Growing neurons Overview
Overview Neurons are usually “grown” in two steps. First, they reproduce to become more cells. This is the intuitive meaning of cells growing (at least to me), and will be the subject of this post. Then, they are differentiated into the necessary neuronal cells that make up the culture. These are broadly divided into neural cells and glial cells.
Neural cells These are the cells that are typically depicted as brain cells in popular culture.
-
Cryopreservation
Overview Let’s suppose you want to store cell lines for future use. The most obvious option would be to put them in an incubator and let them continue growing. But this would require some maintenance, and it’s pretty inconvenient if you want to do other things like move the cells. Another option might be to freeze them. But this has a pretty high liklihood of killing cells. When water freezes, the ice crystals in the cell can wreak havoc on the cell.
-
MAP kinase
Overview I’ve been learning about systems biology recently, and MAP Kinase seems to come up a lot. Systems biology is all about drawing maps between various biological processes like which genes create what proteins and how those proteins interact with each other. MAP kinase is often shown as an intermediary between various processes. MAP stands for Mitogen Activated Protein. This seems pretty self-explanatory if we understand what a “Mitogen” is.
-
Immortal cell lines
Overview Say you want to study a new drug, and you want to see if there are any interesting effects on human tissue. Maybe you’ve infected the tissue with a virus, and you want to see if the drug does what you think it does. It’s still early in the study, so you don’t want to give it to real humans yet.
This is a very common practice, but it assumes that you can get tissue easily.
-
Building proteins
Overview I’ve been wondering about the differences between proteins and enzymes, and thought it would be good to start from first principles. In this post, I wanted to talk broadly about how proteins are made from DNA.
Amino acids DNA is made of strings like GCCCGTAATAGTACATTACGA; This is translated in triplets into amino acids, and groups of amino acids produce proteins. So, if we grouped this into triplets, it would look like: (GCC)(CGT)(AAT)(AGT)(ACA)(TTA)(CGA).
-
Lac operon
Overview The first word in “lac operon” refers to lactose, and the second word refers to the structure of the genes. Usually, when people discuss the lac operon, they do so in the context of e. coli. Though e. coli is not the only bacteria that can have the lac operon, it’s usually what people are referring to. I will continue that tradition.
Lactose is a type of sugar often found in milk.